DNA, B-form, double-stranded, 50 base pairs 3d model
3dmdb logo
GrabCAD
DNA, B-form, double-stranded, 50 base pairs

DNA, B-form, double-stranded, 50 base pairs

by GrabCAD
Last crawled date: 2 years ago
DNA-B-form atomic structure, surface;
Generated in pymol, mesh-simplified in meshlab to reduce file size;
DNA sequence:
TGCTAAGGATCTGGCTGCATGCTATGTTGATACACCTACACTGCTCGAAG
(randomy generated using https://faculty.ucr.edu/~mmaduro/random.htm)

PDB file generator:
http://www.scfbio-iitd.res.in/software/drugdesign/bdna.jsp#

I've printed these with Makerobot.

I also uploaded two separate strands as two separate files; it might be possible to print them separately in a rubbery material and wind them up together (head-to-tail, of course, b.c. DNA is antiparallel'). However, I haven't attempted this yet.

Tags